#These authors contributed equally to this paper
It was rarely reported about strawberry vein banding virus (SVBV) genome sequence in China and most countries worldwide. In this work, we determined the complete genome sequences of two SVBV isolates in China, designated SVBV-AH and SVBV-BJ, that were obtained from naturally infected strawberry samples from Anhui province and Beijing city of China, respectively. The complete genomes of SVBV-AH and SVBV-BJ were 7,862 nucleotides (nts) and 7,863 nts long, respectively, and both constituted with seven genes typical of the caulimoviruses. Alignment of complete nucleotide sequences showed that SVBV-AH and SVBV-BJ shared a significant nucleotide sequence identity of 97.7% of each other and had 85.7% and 86.0% sequence identity related to SVBV from the United States (SVBV-US), respectively. Phylogenetic trees, based on the alignment of complete nucleotide sequences and amino acid sequences of Coat Protein (CP), both showed that SVBV-AH and SVBV-BJ clustered into one branch with all the other SVBV isolates, and other species of caulimoviruses clustered into another tree branch. It illustrated that all the SVBV isolates had an extremely high relationship but had a distant relationship with other species of caulimoviruses. We further confirmed that SVBV-AH infectious clone could cause similar symptoms to SVBV-infected in strawberry under natural conditions. Taken together, our study provided valuable information to elucidate the origin and dissemination of SVBV Chinese isolates, meanwhile providing the necessary vector for studying the gene functions of strawberry.
Strawberry vein banding virus (SVBV) was originally described as a distinct virus infecting strawberry in 1955 (
SVBV is a well-defined virus species and classified as a member of the genus
In our research, we reported two complete nucleotide sequences of SVBV isolates in naturally infected strawberry plants from China. Phylogenetic relationships and nucleotide sequence identities between the two SVBV China isolates (SVBV-AH and SVBV-BJ) and other previously characterized isolates of caulimoviruses were analyzed.
Field samples were collected in cultivated strawberry (
The total DNA of the two samples was extracted from 100 mg of leaf tissues using the CTAB method (
Primername | Nucleotide sequence (5’–3’) |
---|---|
SVBV-R-F | GGTACCGACAGGTAATTATTGGTATCCTAC |
SVBV-R-R | TACATGCTTGTTTGCTGTACACATAC |
SVBV-L-F | GATTCCGTCGAATCAGAAGAAC |
SVBV-L-R | GTTGCATGCGGAAGTCTTGTTG |
The 3’-A added DNA products were cloned into a pMD18-T vector (TaKaRa, Dalian, China) using TA-cloning strategy followed by transformation of chemically competent
Each sequence was assembled into the full-length SVBV genome by using the sequence assembly program SeqMan (Lasergene 7.1.0, DNASTAR Inc, USA). Snap Gene Viewer (GSL Biotech, Chicago, IL) was used to search for potential ORFs in the genome. Sequence analyses comparison of the SVBV-AH and SVBV-BJ to the reference sequences were performed using the DNAStar 5.01 package (DNASTAR, Madison, USA). Complete nucleotide sequences of other isolates of
Molecular phylogenetic tree analysis was performed by using MEGA5 software, and the phylogenetic trees were constructed by the neighbor-joining method with 1,000 bootstrap replicates. Detailed information of caulimoviruses used for comparisons (including GenBank accession number, the abbreviations, and the region where it was isolated) are shown in phylogenetic trees.
The detailed construction procedures of the SVBV infectious clone (pBin-1.25SVBV-AH) were described previously (
The complete genomes of SVBV-AH (GenBank Accession No. KX787430) and SVBV-BJ (GenBank Accession No. KR080547) are 7,862 nts and 7,863 nts in length, respectively. The complete genome sequences of SVBV-AH and SVBV-BJ both existed in a large untranslated region (UTR) and some small intergenic regions (IRs) between ORFs. The length of the large untranslated region between ORF VI and ORF VII of SVBV-AH and SVBV-BJ is 516 nts and 515 nts, respectively. Additionally, the complete genomes of two SVBV isolates also present a relatively small intergenic region of 91 nts between ORF VI and ORF VII and 2 nts intergenic space between ORF I and ORF II, ORF III, and ORF IV. The interval between ORF V and ORF VI of SVBV-AH is 11 nts, and that of SVBV-BJ is 12 nts. Moreover, ORF II and ORF III of two SVBV isolates are continuous.
Sequence analysis revealed that the genomes of SVBV-AH and SVBV-BJ contain seven open reading frames (ORFs) that encode seven proteins, respectively. The speculated functions of the corresponding putative proteins of SVBV-AH are as follows: ORF I encodes a 37.9 kDa viral movement protein (MP) P1 with a main function domain between 37 to 228 aa which is conserved in caulimoviruses. It was known that viral MP could facilitate intracellular trafficking of the viral genomes and assist the spread of the viral replication complexes between plant cells. Beyond that, P1 of CaMV could interact with the plasmodesmata and possessed the ability to bind viral RNA to achieve its cell-to-cell movement (
ORF II encodes an 18.5 kD protein P2. P2 is acquired by aphids to associate with aphid transmission of the virus that is found in various caulimoviruses; P2 was also known as the aphid transmission factor (ATF) and could assist plant–plant transmission of a non-transmissible CaMV isolate from crude extracts of infected plants (
ORF III encodes a 13.4 kD protein, and no conserved motif could be found in P3 of SVBV. However, P3 of CaMV contains a C-terminal basic domain located at 112–126 aa, which possesses non-sequence-specific DNA binding activity. P3 is also essential for the infection cycle. Interaction of P3 with P2 could promote the efficiency of aphid transmission, and it is a second ‘helper’ factor required for CaMV transmission by aphids (
ORF IV encodes a 55.3 kDa protein P4, P4 contains a C2HC type zinc-finger conserved domain at amino acid position 396–412, which is a typical component of the coat protein of all caulimoviruses. P4 plays an important role in the encapsulation of viral DNA and is frequently used for serological detection of caulinoviruses (
ORF V encodes an 80.7 kDa multifunctional protein P5. P5 of CaMV has been proved to be a polyprotein precursor, and it possesses activities of proteinase, reverse transcriptase, aspartate proteinase, and ribonuclease H. There are four predicted conserved domains present in P5 of SVBV. A reverse transcriptases (RTs) domain located at 301–481 aa and an RNA-dependent DNA polymerase domain located at 325–481 aa were reported to be conserved in caulimoviruses. In addition, P5 also contains a Ribonuclease H (RNase H) domain located at 576–698 aa and a peptidase A3 domain close to the N-terminus (
ORF VI encodes a 59.9 kDa protein P6. The function of P6 is predicted as the viroplasmin proteins of caulimoviruses. Viroplasmin protein is reported as the main components of viral inclusion bodies and responsible for viral assembly and accumulation. P6 of CaMV is a multifunctional protein and is probably involved in controlling the specificity of virus-host interaction, the severity of host symptom, and the translational transactivation of other ORFs of CaMV (
No conserved motif could be detected in protein encoded by ORF VII of SVBV, and also no related research works about P7 of CaMV were reported till now.
Although the size of each ORF of SVBV-BJ has some differences from that of SVBV-AH, the putative functions of proteins of SVBV-BJ are identical to the corresponding proteins of SVBV-AH. More information on the encoded proteins of the two SVBV isolates is present in
ORF | Length (bp) | Position (nt) | Encoded |
Length (aa) | Predicted molecular |
---|---|---|---|---|---|
I | 990 | 70–1059 | P1 | 329 | 37.9 |
II | 489 | 1062–1550 | P2 | 162 | 18.5 |
III | 351 | 1551–1901 | P3 | 116 | 13.4 |
IV | 1416 | 1904–3319 | P4 | 471 | 55.3 |
V | 2115 | 3411–5525 | P5 | 704 | 80.7 |
VI | 1563 | 5537–7099 | P6 | 520 | 59.9 |
VII | 315 | 7616–68 | P7 | 104 | 12.2 |
ORF | Length (bp) | Position (nt) | Encoded |
Length (aa) | Predicted molecular |
---|---|---|---|---|---|
I | 990 | 70–1059 | P1 | 329 | 37.9 |
II | 489 | 1062–1550 | P2 | 162 | 18.5 |
III | 351 | 1551–1901 | P3 | 116 | 13.4 |
IV | 1416 | 1904–3319 | P4 | 471 | 55.3 |
V | 2115 | 3411–5525 | P5 | 704 | 80.7 |
VI | 1566 | 5538–7103 | P6 | 521 | 60.0 |
VII | 324 | 7617–77 | P7 | 107 | 12.5 |
The complete genome sequences comparison showed that all 14 SVBV isolates shared relative high sequences homology (85.7%–97.7%) with each other. Among them, SVBV-AH and SVBV-BJ shared very high nucleotide sequence identity (97.7%) with each other, and 96.5%–98.6% sequence identity with other SVBV China isolates. Besides, they shared 97.7% and 97.4% sequence identity with the Japan isolate, while they had relatively lower sequence identity with Canada isolate (92.3% and 92.9%) and only 85.7% and 86.0% sequences identity with SVBV-US, respectively. SVBV-AH and SVBV-BJ shared 43.9%–46.1% sequence identity with other 12 members of caulimoviruses and had only 44.4%–44.7% nucleotide sequence identity with 5 isolates of CaMV. Although the genome structure of SVBV and CaMV was very similar, the sequence identity of the complete nucleotide sequences of SVBV and CaMV was very low. It was probably due to SVBV and CaMV infecting different families of hosts, SVBV infects Rosaceae plants, and CaMV infects Brassicaceae plants (
Despite the remarkable identity of the arrangement of the ORFs of SVBV-AH and SVBV-BJ isolates to that of other caulimoviruses, the ORFs of our two SVBV isolates share relatively lower amino acid sequences identities (13.5%–58.2%) with the corresponding ORFs of other species of caulimoviruses. Among them, ORF II, ORF III, and ORF VI of our two SVBV isolates had very low amino acid sequence identity (13.5%–23.0%) with the corresponding ORFs of other species of caulimoviruses, whereas ORF V of two SVBV shared relatively higher amino acid sequence identity (55.9%–58.2%) with that of other species of caulimoviruses. Both the full length and ORFs amino acid sequences of the SVBV-AH and SVBV-BJ isolates share extremely high identity (97.7% and 96.2%–100%) with each other. It could be suspected that the two SVBV had distant evolutionary relationships with other species of caulimoviruses in ORF II, ORF III, and ORF VI, and ORF V of two SVBV had a relatively closer evolutionary relationship with that of other species of caulimoviruses (
Virus | Accession No. | Genomea | ORF Ib | ORF IIb | ORF IIIb | ORF IVb | ORF Vb | ORF VIb | ORF VIIb | IRa |
---|---|---|---|---|---|---|---|---|---|---|
SVBV-AH | KX787430 | — | — | — | — | — | — | — | — | — |
SVBV-BJ | KR080547 | 97.7 | 99.1 | 98.9 | 100 | 99.2 | 99.6 | 96.2 | 98.8 | 98.6 |
SVBV-US | X97304 | 85.6 | 86.6 | 69.8 | 78.6 | 90.5 | 94.3 | 86.4 | 80.9 | 84.6 |
CaMV-XJ | AF140604 | 44.4 | 32.7 | 16.1 | 18.4 | 26.6 | 53.1 | 19.5 | 43.6 | 36.3 |
CaMV-B29 | X79465 | 44.6 | 32.0 | 20.5 | 18.4 | 31.9 | 54.1 | 22.4 | 15.5 | 48.0 |
CaMV-Cabb | KJ716236 | 44.5 | 32.3 | 20.5 | 18.4 | 31.8 | 54.1 | 22.2 | 16.5 | 46.9 |
CaMV-IRNRkh22 | JX912267 | 44.4 | 32.0 | 20.5 | 18.4 | 31.8 | 54.2 | 21.0 | 14.4 | 48.3 |
CaMV-TUR5 | AB863169 | 44.5 | 32.6 | 19.9 | 18.4 | 32.2 | 54.2 | 21.0 | 14.4 | 48.0 |
DaMV P2 | JX272320 | 45.2 | 33.3 | 17.2 | 14.9 | 24.4 | 49.8 | 21.3 | 51.2 | 44.0 |
FMV | X06166 | 46.0 | 31.5 | 16.5 | 22.2 | 30.8 | 52.0 | 20.6 | 42.6 | 30.3 |
HrLV ID1 | JX429923 | 44.0 | 30.8 | 19.4 | 18.4 | 27.9 | 50.9 | 19.8 | 38.3 | 35.5 |
MiMV | AF454635 | 45.1 | 33.4 | 16.8 | 15.5 | 25.5 | 52.3 | 22.7 | 34.3 | 38.2 |
CERV-Indian | AJ853858 | 44.6 | 29.0 | 21.7 | 13.5 | 27.5 | 51.1 | 17.5 | 28.0 | 35.0 |
CERV | NC_003498 | 46.3 | 29.4 | 23.7 | 11.4 | 27.6 | 51.7 | 19.3 | 21.1 | 42.8 |
LLDAV | EU554423 | 46.4 | 16.0 | 23.4 | 24.8 | 28.3 | 49.8 | 18.3 | NA | 35.3 |
SPuV | JQ926983 | 45.9 | 31.4 | 20.4 | 25.9 | 26.0 | 51.9 | 19.9 | NA | 48.2 |
Note: a Nucleotide sequence identity; b Amino acid identity; NA, not assessed.
A phylogenetic dendrogram was performed to determine the evolutionary relationship based on the complete nucleotide sequences of 14 SVBV isolates aligned with other species of caulimoviruses derived from different geographic areas. As shown in
A phylogenetic tree of the amino acid sequences of ORF IV of SVBV was constructed based on 14 SVBV isolates and other representative species of caulimoviruses. From the phylogenetic tree, it was found that all caulimoviruses were distributed into two major branches. SVBV-AH and SVBV-BJ clustered into a separate branch together with other 10 SVBV isolates except for SVBV-NS8 (Canada) and SVBV-USA, indicating that 12 SVBV isolates from China and Japan had extremely close evolutionary relationships with each other but had a relatively distant relationship with SVBV isolates from Canada and USA. Besides, DaMV, MiMV and FMV clustered into a sub-branch, and LLDAV, SpuV, CERV, HrLV and 5 CaMV isolates clustered into another sub-branch. We could find that the structures of the two phylogenetic trees were extremely similar. It could be illustrated that the phylogenetic relationships of amino acid sequences of ORF IV could reflect the relationships of caulimoviruses to some extent, and the evolutionary relationship is almost consistent with the geographical distribution of all the viruses (
In our previous study, the first complete genome sequence of SVBV from China (SVBV-CN) was reported. Now, we determined two novel SVBV isolates derived from other regions of China and described the complete nucleotide sequences and the genetic characterization of the two SVBV isolates. Although further and more detailed research is desirable, the results of the present study help us deeply understand the genetic diversity of SVBV isolates in China and benefit us to reveal the regulation of epidemiology and evolution of SVBV throughout the world.
(A) Phylogenetic tree based on the complete nucleotide sequences of two SVBV China isolates and other 14 caulimoviruses. (B) Phylogenetic tree based on the amino acid sequences of ORF IV of two SVBV China isolates and other 14 caulimoviruses. The trees were constructed using MEGA version 4.1 by the observed-divergency method with 1000 bootstrap replicates, and the bootstrap values (>90%) are shown. The length of the branches and the percentage of bootstrap frequency are indicated. (A) Complete genome (B) ORF IV.
The
We collected the samples from newly developed leaf tissues 25 days after SVBV-AH infection to prevent possible cross-contamination. Southern blot analysis confirmed the SVBV DNA accumulation in SVBV-AH infected
Anhui province has a large strawberry planting area, where virus diseases seriously damage the yield and quality of strawberry fruits. Therefore, it is urgent to breed some new resistant varieties suitable for cultivating in Anhui province. Inoculation with local SVBV isolate could reflect the actual resistance level of the new strawberry varieties in Anhui province more accurately.
(A)
The undergraduates Xuechun Kou and BingJin Luo of Anhui agricultural university also participated in sample collection and data processing in this study.