#These authors contributed equally to this work
Photobiomodulation (PBM) has been shown to delay the pathological process of heart failure, but the exact mechanism of action is not clear. Mitochondria occupy one-third of the volume of mammalian cardiomyocytes (CMs) and are central transport stations for CM energy metabolism. Therefore, in this study, we explored the regulatory effects of 630 nm light-emitting diodes (LED-Red) on the mitochondria of CMs. The results show that LED-Red-based PBM promotes adenosine triphosphate (ATP) synthesis by upregulating the expression of glycolipid metabolizing enzymes. Correspondingly, there was an improvement in the activity of succinate dehydrogenase (SDH), a key enzyme in the mitochondrial electron transport chain, and the mitochondrial membrane potential. Meanwhile, LED-Red affected the state of mitochondrial oxidative stress and promoted the generation of reactive oxygen species (ROS), but the increased ROS production did not damage the CMs. In addition, mitochondrial division and fusion were also affected by the stimulation of LED-Red. Finally, PBM treatment led to a significant increase in transcript levels of mitochondrial transcription factor A (TFAM), which controls the stability of the mitochondrial genome. Collectively, irradiation with LEDs at 630 nm played a regulatory role in mitochondrial function, suggesting that mitochondria appear to be the recipients of PBM treatment. This study provides more insights into the mechanisms underlying PBM treatment in heart diseases.
Photobiomodulation has been shown to exert many regulatory effects on the physiological activities of a multitude of tissues and organs (
Mitochondria are the “energy factories” of CMs and provide a constant supply of ATP for excitation-coupled contraction through oxidative phosphorylation of fatty acids and transmission of electron respiratory chains. CMs have the largest number of mitochondria, with approximately 5,000–8,000 mitochondria per cell. Thus, the homeostasis of mitochondria is important for the physiological and pathological activity of CMs. Ischemic cardiomyopathy is a precursor to the development of heart failure, and mitochondrial dysfunction plays a key role in the pathology of ischemic heart disease (
Currently, the impact of PBM on the pathophysiology of the heart remains inadequate. This is not conducive to the development of PBM for cardiovascular applications. Therefore, this study aimed to investigate the effect of LEDs irradiation at 630 nm on the function of mammalian mitochondrial CMs and homeostasis.
This study was approved by the Medical Ethics Committee of the Second Affiliated Hospital of Harbin Medical University (No. KY2021-363). First, hearts of newborn Kunming mice were isolated and subjected to trypsin (T1300, Solarbio, Beijing, China) digestion. The digest was centrifuged (4°C, 1500 rpm, 5 min) after filtration, and the precipitate was collected. The precipitate was added to the complete culture solution, including Dulbecco’s modified Eagle’s medium (DMEM; D6429; Sigma, USA), 10% fetal bovine serum (Gibco, Grand Island, USA), and 1 × penicillin and streptomycin (Life Technologies, Grand Island, USA), spread evenly, transferred to cell bottles, and incubated at 37°C, and 5% CO2, in 95% humid air for 90 min. The upper layer of unadhered cells was collected, and the cell density was adjusted by adding the culture solution. This was then spread to a plate covered with gelatin wells and incubated in an incubator for 24 h before treatment.
A 630 nm light emitting diode with a spot area of about 10 cm2 was placed vertically above the cell well plate. Next, the power density of the light source was measured using a light source power density meter, and the vertical distance between the light source and the cell well plate was adjusted so that the final power density was maintained at 2.5 mW/cm2 and irradiated for 10 min. The Non-LED group was illuminated under the same environmental conditions as the LED-Red group but without turning on the switch of the light source.
To analyze cellular ATP content, the ATP assay kit (S0027, Beyotime, Beijing, China) was used. The culture solution was aspirated from the cell well plate, and 200 µL of lysate were added to each well. After lysis, the mix was centrifuged at 4°C and 12000 g for 5 min, and the supernatant was removed for subsequent assays. An appropriate amount of ATP assay reagent was adjusted according to the manufacturer’s instructions. Then, 100 µL of ATP assay working solution was added to the assay wells and left at room temperature for 3–5 min. To the test wells, 20 µL of the sample was added, mixed rapidly, and the RLU value was measured with a luminometer after an interval of at least 2 s.
The working assay solution was prepared according to the SDH assay reagent instructions (BC0955, Solarbio, Beijing, China). After cell digestion and centrifugation, the supernatant was aspirated and used to detect SDH activity. The absorbance values were measured at 600 nm on a visible spectrophotometer, and the SDH activity was calculated and analyzed for each group.
CMs were cultured in 12-well plates, and the mitochondrial membrane potential was analyzed using the JC-1 assay kit (C2003S, Beyotime, Beijing, China). After light stimulation, the culture solution in the well plates was discarded, and the cells were washed three times with PBS. Then, the JC-1 solution was added, incubated for 20 min at 37°C, washed again with PBS, and the changes in mitochondrial membrane potential were observed under fluorescence microscopy. The red fluorescence represents an increase, and the green fluorescence indicates a decrease in mitochondrial membrane potential. Then, the mitochondrial membrane potential was quantified by fluorescence analysis using the software image J. The red and green fluorescence values were measured separately for each group, and then the red fluorescence value/sum of red and green fluorescence was calculated as the relative increase of mitochondrial membrane potential for each group.
CMs were inoculated in 96-well plates and ROS were detected using the Reactive Oxygen Species Assay Kit (S0033S, Beyotime, Beijing, China). The assay was performed according to the manufacturer’s instructions. Then, the cells were washed three times with PBS, and DMEM and DCFH-DA probes were prepared in a ratio of 1:1000. Appropriate volumes of probes were added to the well plates and incubated for 20 min at 37°C. Excess unloaded probes were then removed, and the fluorescence of each group was detected using a fluorescent enzyme marker.
The TUNEL Apoptosis Assay Kit (C1089, Beyotime, Beijing, China) was used to analyze apoptosis. CMs were first washed once with PBS after LED-Red stimulation. The cells were fixed in 4% paraformaldehyde for 30 min and then washed once with PBS. Next, the cells were permeabilized with PBS containing 0.3% Triton X-100 for 90 min. 50 µL TUNEL assay solution was added to each well according to the manufacturer’s instructions and incubated for 60 min at 37°C in a dark environment. Finally, the cell nuclei were labeled with DAPI, and apoptosis was observed by fluorescence microscopy.
Cells cultured in glass dishes received LED-Red stimulation. The culture medium was removed, and the cells were washed three times with Hanks buffer. Cells were incubated in 500× MitoTracker (22675, AAT Bioquest, California, USA) stain at 37°C with 5% CO2 for 40 min; then, the stain was discarded. Hanks buffer and Hoest3342 stain were added to re-stain and label the nuclei. Mitochondrial division and fusion were observed by a confocal laser scanning microscope (FV10i; Olympus, Japan). Labeled mitochondria appeared green, and the labeled nuclei appeared blue.
Total RNA of CMs was extracted using TRIzol reagent (Invitrogen, California, USA). The RNA samples were then reverse transcribed to cDNA. SYBR Green PCR Master Mix (Applied Biosystems, USA) was used for qRT-PCR. The sequences of the main primers are indicated in
Gene | Forward primer | Reverse primer |
---|---|---|
ATGGGCTGTGATCGGAACTG | TTTGCCACGTCATCTGGGTTT | |
GTGACGTTGACATCCGTAAAGA | GCCGGACTCATCGTACTCC | |
ACACTGGTCCTAGCTGTATTCT | CCAGCCACGTTGCATTGTA | |
AGGGAGGTCGAGCTGTTCTC | GGAGTGTTCACTAAGCGGTCA | |
CCGTAAATCTGCGGGATGATG | CAGTTTCGTTCGACCTGCGTAA | |
CTTCACCTTGGTCTCGGTGT | AGGAGCAGAGCCACAGTCAT | |
GGCGGCTTGGTGACTCTAGATAAC | CCTGCTGCCTTCCTTGGATGTG |
Cells were scraped by adding an appropriate volume (20–60 µL) of cell lysate depending on cell density and state. Protein concentration was determined using the BCA Protein Concentration Assay Kit (P0012, Beyotime, Beijing, China). An appropriate concentration of SDS-polyacrylamide gel was used for electrophoresis according to the corresponding molecular weight of the incubated antibody. Membranes were then blocked in 5% non-fat milk for 90 min at room temperature and incubated with antibody against Platelet glycoprotein 4 (CD36; 1:1000; YT5585, Immunoway, USA), Recombinant Carnitine Palmitoyltransferase 1A (CPT1A; 1:1000; DF12004, Affinity, USA), Phosphorylated Dynamin-related protein 1 (p-DRP1; 1:500; YP1318, Immunoway, USA), Peroxisome proliferator-activated receptor gamma coactivator 1-alp (PGC-1α; 1:1000; YM0519, Immunoway, USA), Solute carrier family 2 facilitated glucose transporter member 4 (Glut4; 1:1000; YT5523, Immunoway, USA), Transcription factor A mitochondrial (TFAM; 1:1000; YT2916, Immunoway, USA), and pyruvate dehydrogenase kinase isozyme 4 (PDK4; 1:1000; DF7169; Affinity, USA) 4°C overnight. The membrane was finally incubated with horseradish peroxidase (HRP)-conjugated secondary antibody for 1 h at room temperature and scanned by Odyssey (LI-COR Biosciences, Lincoln, NE, USA).
Data are expressed by means ± SEM. Comparisons between two groups were made using Student’s
Mitochondria are subcellular organelles that serve as the main source of energy supply for CMs. The efficiency and amount of ATP synthesis are critical for the contractile activity of CMs. Therefore, we irradiated mammalian CMs using 630 nm light-emitting diodes. The results showed that low-energy LED-Red irradiation for 10 min led to an increase in intracellular ATP content (
Mammalian CMs synthesize ATP in the mitochondria, and aerobic respiration is predicated on the oxidative phosphorylation of fatty acids and glycolysis. The above-mentioned experiments revealed that LED-Red promotes ATP synthesis in CMs. Therefore, we next explored whether ATP production correlates with the uptake and consumption of energy substrates by CMs. In the subsequent experiments, we examined the expression of enzymes related to glycolipid metabolism in CMs. qRT-PCR results showed that lipid metabolism genes CD36 and PDK4 expression were significantly upregulated after LED-Red irradiation, compared with the Non-LED group. Among the glucose metabolism genes, CPT1A expression was up-regulated. In addition, the expression of PGC1-α, which regulates mitochondrial biosynthesis, and energy metabolism, also increased due to LED-Red stimulation (
PBM alters the process of mitochondrial oxidative stress (
Mitochondria are dynamic organelles that control the number and size of mitochondria through constant division and fusion (
Mitochondria have a separate genome, and the integrity of the mitochondrial genome is critical for multicellular organisms. TFAM was originally cloned as a transcription factor and is essential for the maintenance of mitochondrial DNA (
PBM is a non-genetic, non-invasive medical technology, and there is increasing evidence of the modulatory effects of PBM on organismal activity (
The heart requires uninterrupted excitation-coupled contractions and, therefore, also results in permanently high energy demands. However, the heart has a limited capacity for energy storage, and therefore, CMs contain a large number of mitochondria, which account for about 30% of the CM volume and provide about 95% of the ATP for the heartbeat (
PGC-1α was first identified in brown adipose tissue, and it interacts with PPARγ to participate in the regulation of mitochondrial metabolism and biogenesis (
In conclusion, we investigated the effects of LED-Red on mitochondrial biological functions in CMs. We found that LED-Red could promote ATP synthesis, mitochondrial division, and mitochondrial TFAM expression in CMs. This is of great scientific significance for the future investigation of PBM for the treatment of ischemic cardiomyopathy and understanding the molecular mechanism of the treatment. However, this research is still limited, as we did not validate the effect of LED-Red on CM mitochondria under pathological conditions, and elucidating this mechanism is important for future studies on the function of PBM in cardiovascular diseases.