Lysophosphatidylcholine acyltransferase 1 (LPCAT1) is a phospholipid acyltransferase that promotes phospholipid synthesis and plasma membrane reconstruction. Exosomes play an important role in tumor metastasis. The release and uptake of exosomes are key steps of their functions and depend on plasma membrane fusion and plasma membrane receptors, respectively. The purpose of this study was to explore whether LPCAT1-induced plasma membrane remodeling would change the secretion and uptake behavior of exosomes in tumor cells. We first confirmed the abnormally high expression of LPCAT1 in colorectal cancer cells by quantitative real-time PCR (qPCR) and Western blot analysis. Then, SW620 cells were used as exosome source cells, and SW480 cells were used as exosome receiver cells. Exosomes from SW620 cells could effectively promote the migration of SW480 cells. When LPCAT1 expression was reduced via siRNA knockdown in the source cells, the secretion of exosomes was downregulated, thus weakening the pro-migratory effects of exosomes on target cells. Conversely, when LPCAT1 was knocked down in target cells, the uptake of exosomes in target cells also decreased sharply. These results undoubtedly revealed that LPCAT1 is functionally associated with the release and internalization of exosomes in colorectal cancer cells and could affect the paracrine effects of exosomes, preliminarily extending the classical metabolic function of LPCAT1 to exosome-related pathways.
Lysophosphatidylcholine acyltransferase 1 (LPCAT1) is an important enzyme involved in complex lipid metabolism. It is widely found in plants and animals and has acyltransferase and acetyltransferase activities (
Exosomes are membranous vesicles with a diameter of about 30–100 nm. After the fusion of multivesicular bodies (MVBs) and the cell membrane, exosomes can be released into the extracellular matrix. They are widely distributed and originated and can be secreted by a variety of cells (
Therefore, the abnormal expression of LPCAT1 may be associated with exosomal signal transduction. We explored the relationship between LPCAT1 and exosome release and uptake, as well as the autocrine or paracrine effects of exosomes on colorectal cancer cells.
The human colorectal cancer cell lines, including HCT116, SW620, and SW480, were obtained from the Cell Resource Center, Peking Union Medical College. Human colon fibroblast CCD-18Co cells were purchased from The American Type Culture Collection (CRL-1459). All the cells were cultured in high-glucose DMEM (Invitrogen, Carlsbad, CA, USA) supplemented with 10% (v/v) fetal bovine serum (FBS; Invitrogen) at 37°C with 5% CO2.
Cells were plated in 24-well or 6-well plates and transfected with 10 nM siRNAs (Ruibo Bio, Guangzhou, China) using Lipofectamine 2000 (Invitrogen) according to the manufacturer’s recommendations.
Cells were cultured in DMEM supplemented with 10% exosome-depleted FBS for 48 h. Exosomes from the cultured supernatant were prepared using the ExoQuick-TC kit described by the manufacturer (System Biosciences, Mountain View, CA, USA). In general, the culture medium was centrifuged at 3000 ×
Nanoparticle tracking analysis (NTA) was used to detect the prepared exosome samples. In few words, exosomes resuspended in 50 μL PBS, which were detected by NanoSight NS-300 (Malvern Panalytical, Malvern, UK), were further diluted to 300-fold to obtain between 20 and 100 objects per frame. Each sample was measured in triplicate via the camera, whose acquisition time is 30 s. Meanwhile, the detection threshold was set to 3. There are at least 200 complete analyses in each video. NTA 2.3 software was applied to collect and analyze the result.
Exosomes were isolated and resuspended in 100 μL PBS, and 50 μL of the suspension was placed onto formvar carbon-coated copper grids at room temperature for 20 min. The excess suspension was removed using filter paper. Exosomes were stained with 2% phosphotungstic acid (PTA) at room temperature for 1 min. The grids were fixed with 2% glutaraldehyde at room temperature for 5 min. Images were obtained with a transmission electron microscope (JEM-1230, Jeol, Ltd., Japan).
With lipophilic tracer PKH67 solution (Sigma-Aldrich, St. Louis, MO, USA), the 40 μg of protein equivalents of exosomes were incubated at 37°C for 10 min. The PKH67-labeled exosomes were purified by using Amicon® Ultra-15 filter (#UFC901024,10 kDa MWCO) according to the manufacturer’s suggestion (Merck Millipore, Danvers, MA, USA). The cells were seeded on 6-well plates (1 × 104 cells/well) and incubated for 24 h. The PKH67 labeled exosomes of 20 μg were added to the receptor cell culture medium and incubated at 37°C for 4 h. Receptor cells were washed with PBS three times, fixed with 4% paraformaldehyde at room temperature for 10 min, and permeated with 0.1% Triton X-100 for 5 min. Then the cells were stained with DAPI and visualized through a fluorescence microscope (IX71, Olympus, Japan).
The RIPA lysis buffer (Beyotime Institute of Biotechnology, Beijing, China) was used to extract total exosomal and cellular protein. The BCA protein assay kit (Beyotime Institute of Biotechnology, Beijing, China) was applied to determine the protein concentrations of cell and exosome lysates. As for the analyses of Western blot, the cellular and 10 µg/well exosomal proteins were separated by electrophoresis in 10% sodium dodecyl sulfate-polyacrylamide gel electrophoresis and finally transferred to polyvinylidene difluoride membrane (PVDF) (Amersham, Buckinghamshire, UK). In TBS-T, 5% skimmed milk (10 mM Tris-Cl, pH 8.0, 150 mM NaCl, 0.5% Tween 20) was used to block the membrane at 4°C overnight and to rinse it three times (10 min/time). After doing this, using the specific primary antibodies (1:1000 dilution) to incubate the membrane for 3 h at room temperature, and using the second antibody (1:5000 dilution) to incubate it for 1 h. ECL developer (Thermo Scientific) was added, and exposure imaging was performed through Odyssey gel imaging system. The specific antibodies to LPCAT1 (ab214034), CD81 (ab109201), HSP70 (ab181606), Calnexin (ab22595) and TSG101 (ab125011), were purchased from Abcam (Cambridge, UK). β-actin antibody (#4970) was acquired from Cell Signaling Technology (Danvers, MA, USA).
By using TRIzol reagent (Invitrogen, CA, USA), total RNA can be extracted. And by using a Revert Aid First Strand cDNA Synthesis Kit (Thermo Scientific, CA, USA), reverse transcription of cDNA was carried out. On ABI 7500 Real-Time PCR System (Applied Biosystems, Warrington, UK), Gene-specific PCR amplification was performed with Power SYBR Green Master Mix. After the expression of GAPDH was normalized, relative gene expression can be calculated via the 2−ΔΔCt method.
An All-in-One miRNA qRT-PCR Detection Kit (GeneCopoeia, MD, USA) was applied to detect the expression of miRNA. To put it shortly, in order to add poly-A tails to the 3’-end of miRNAs, total RNA was treated with poly-A polymerase.
To reverse transcribe miRNA tailed poly-A, M-MLV RTase was used with a universal adaptor PCR primer. Then, the expression of microRNA was measured by performing real-time qPCR using SYBR Green. RNU6B was adopted as an internal control for miRNAs in cells. miRNAs in exosomes were normalized to synthetic spike-in control
In
Cell proliferation capacity was measured using the CCK8 assay. The digested cells, 3 × 103 cells/well, were seeded into the 96-well plate. Incubate in a 5% CO2 incubator at 37°C for various time points, discard the original culture medium, add 100 µL of the mixture of CCK8 reagent (DoJinDo Laboratories, Japan) and medium at the ratio of 1:9, and incubate in the incubator for additional 1 h. The absorbance values of 450 nm wavelength were determined by an enzyme labeling instrument (Multimode Reader, PerkinElmer, USA).
Transwell cell migration assay was performed with 24-well transwell chamber plates with 8 μm-pore size polycarbonate membranes (BD Biosciences), which were used for analyzing the ability of cellular migration. Cells in serum-free DMEM can be put into the upper chamber, and DMEM, which contains 20% FBS, was applied to the lower chamber. After 18 h, residual cells could be removed from the upper chamber. Then, cells were fixed with methanol, as well as stained with 4', 6-diamidino-2-phenylindole (DAPI) (Thermo Fisher Science). After washing with PBS, under an inverted microscope, the number of cells passing through the membrane was counted (IX71, Olympus, Japan). Three random microscopic fields were selected for carrying out statistical analysis.
Briefly, the exosome pellet was resuspended in 0.1 × PBS and gently mixed with the appropriated µL of miRNA (10 nM) in a final volume of 400 μL into 0.4 cm electroporation cuvettes. Exosomes were then electroporated using a Gene Pulser II Electroporator (Bio-Rad, Hercules, CA, USA) at 300 V and 25 μF of capacitance. Lastly, exosomes were incubated in ice for 30 min to allow the exosome membrane to be fully restored. To get rid of free nucleic acids, exosomes were diluted with cold PBS and isolated again by ultracentrifugation at 120,000 ×
All data were processed via SPSS21.0 software and expressed as mean ± SD. In the meantime, the normality test of Shapiro-Wilk (W) was performed. In terms of non-normally distributed data, the nonparametric Wilcoxon signed-rank test was applied to assess the statistical differences among groups. When the data were close to a normal distribution, multiple sets of data were compared by using one-way ANOVA. In addition, in order to analyze the multiple comparisons of means, the LSD method was adopted.
First, we found abnormally high expression of LPCAT1 (
(A) LPCAT1 expressed in normal and colorectal tumor tissues. Data were acquired from UALCAN by analyzing the TCGA samples. (B) qRT-PCR analysis of LPCAT1 mRNA expression in colorectal cancer cells and normal colon cells. (C–D) Western blot analysis of LPCAT1 mRNA and protein expression in colorectal cancer cells and normal colon cells. One-way analysis of variance with Tukey post-hoc analysis. *
We compared the amounts of exosomes secreted by CCD18-Co and colon cancer cell lines (SW620, SW480, and HCT116) under the same conditions by collecting exosomes from identical volumes of culture supernatant at the corresponding time points. The number of exosomes secreted by the three colorectal cancer cell lines was apparently higher than that secreted by the CCD18-Co cell line (
(A) Exosome concentrations derived from different cells were quantified by NTA. (B, C) The effect of siRNAs on mRNA and protein expression of PFDN1 was examined by qPCR and Western blot. (D–F) Three kinds of colorectal cancer cells (HCT116, SW480, and SW620) were transfected with LPCAT1 siRNA (10 nM). CCK-8 was used to detect cell viability at 24 h and 48 h, respectively. (G) Bar graphs show the effect of LPCAT1 siRNAs on the concentration of exosomes. The relative exosome concentration was normalized to the cell number. Comparisons among groups were determined by one-way ANOVA with Tukey post-hoc analysis. *
The exosomes of tumor cells can promote the migration of target cells through autocrine and paracrine effects, and the strength of this ability usually depends on the characteristics of the source cells (
When the expression of LPCAT1 was knocked down by siRNA in SW620 source cells, the migration promoting capacity of exosomes was significantly lower than that of wild-type exosomes (
(A, B) Cell migration ability was tested by Transwell cell migration assay (Magnification, 200×; Scale bar, 50 µm). The quantifications of cell migration are presented in the histogram. (C, D) The indicated exosomes from different cells were collected under the same conditions (the same number of initial cells, the same culture time, and the same volume of culture medium), resuspended in 50 μL PBS, and co-cultured with SW480 cells for 24 h. The migration ability of SW480 cells in each group was detected by Transwell cell migration assay (Magnification, 200×; Scale bar, 50 µm). The control group was treated with PBS. (E) CCK-8 detection of SW620 cell activity at different time points via co-incubation with exosomes from each of the three types of colorectal cancer cells. (F, G) The exosomes from NC siRNA- or LPCAT1 siRNA-treated SW620 cells were collected and co-cultured with SW480 cells for 24 h. The migration ability of SW480 cells in each group was detected by Transwell cell migration assay (Magnification, 200×; Scale bar, 50 µm). One-way ANOVA with Tukey post-hoc analysis. *
(A) Representative scanning electron micrographs of exosomes purified from SW620 cells treated with NC siRNA or LPCAT1 siRNA. (B) Expression of LPCAT1 and the related exosome markers confirmed by Western blot in cells and exosomes (with a 50-μg protein loading volume). (C) Quantitative PCR was used to detect the relative content of four miRNAs in the three kinds of cells. U6 was used as an internal control. (D) Quantitative PCR was used to detect four miRNAs’ relative content in the same amount of exosomes derived from three kinds of cells. Cel-miR-39 was used as the spike-in control. (E, F) Quantitative PCR verification of the differential expression of miRNAs in cells and exosomes derived from SW620 cells treated with NC siRNA or LPCAT1 siRNA. The relative miRNA expression levels in cells were normalized to U6; the relative amount of the miRNAs in exosomes were normalized to spiked-in cel-miR-39. Comparisons among groups were determined by one-way ANOVA with Tukey post-hoc analysis. *
If LPCAT1 is knocked down in SW480 target cells, the migration ability of the cells itself decreases (
(A, B) The migration ability of SW480 cells treated with NC siRNA or LPCAT1 siRNA was detected by Transwell migration assay. (C, D) SW480 cells were pretreated with NC siRNA or LPCAT1 siRNA for 24 h. The migration ability of SW480 cells in each group after the treatment with exosomes was detected by Transwell migration assay (Magnification, 200×; Scale bar, 50 µm). The control group was treated with PBS. (E) Exosomes from SW620 cells were labeled with PKH-67 and incubated with SW480 target cells for 4 h. The uptake of exosomes by SW480 cells in each group was observed by fluorescence microscopy (Magnification, 400×; Scale bar, 50 µm). (F) Transfection of cel-miR-39 into the exosomes derived from SW620 cells by electroporation to prepare exosomes rich in cel-miR-39. Quantitative PCR was used to detect the relative content of cel-miR-39 in exosomes. ET, electroporation. (G) Detection of the relative contents of cel-miR-39 after co-incubation of exosomes rich in cel-miR-39 with SW480 cells treated with NC siRNA or LPCAT1 siRNA. U6 was used as an internal control. Comparisons among groups were determined by one-way ANOVA with Tukey post-hoc analysis. *
The expression of LPCAT1 is increased in a variety of tumor tissues and is positively correlated with the malignant degree, cancer stage, and tumor grade. LPCAT1 is involved in the regulation of the enzymatic synthesis of lysophosphatidylcholine and unsaturated fatty acid from phosphatidylcholine, while diacylglycerol acyltransferase (DGAT) could synthesize triacylglycerol (TAG) from unsaturated fatty acids and phosphatidylcholine (
Tumor metastasis refers to the process in which malignant tumor cells leave the primary tumor, reach distant tissue or organs through various channels, and continue to proliferate and grow, forming metastatic foci. It is a sign of poor prognosis and a leading cause of death in cancer patients. Studies have shown that tumor metastasis is a multi-factor, multi-step, and dynamic process. Many scholars believe that exosomes from tumors and the metastatic microenvironment play an important role in tumor metastasis, and a large number of studies have been carried out on the function of exosomes in tumor metastasis (
Exosomes originate from the membrane cavity or early endosomes in the plasma membrane circulation pathway, which will sink inward to form intraluminal vesicles (ILVs) and further invaginate through intracellular lysosomal particles to form MVBs. The fusion of MVBs and cell membrane leads to the release of tiny vesicles with lipid bilayer membranes and with a diameter of 30–100 nm to the extracellular matrix. The docking to and subsequent fusion with the plasma membrane of MVBs are regulated by Rab, SNAP, and SNARE proteins (
Unfortunately, we have not been able to further elucidate which specific receptors are affected during LPCAT1-induced plasma membrane remodeling and whether these receptors determine the release and internalization of exosomes in colorectal cells. This requires large-scale follow-up screening and more accurate in-depth research. In addition, knockdown of LPCAT1 in SW620 cells did not significantly change the relative content of some characteristic miRNAs (
In summary, we demonstrated that LPCAT1 is associated with exosomal release and internalization in colorectal cancer cells and that it can affect the paracrine effects of exosomes, extending the classical metabolic function of LPCAT1 to the exosome-related pathway.
heat shock 70 KDa protein
lysophosphatidylcholine acyltransferase 1
multivesicular bodies
nanoparticle tracking analysis
polymerase chain reaction
quantitative reverse transcription-PCR
radio-immunoprecipitation assay
transmission electron microscopy
tumor susceptibility gene 101 protein
Gene name | Primer sequence | Ref Seq |
---|---|---|
LPCAT1 | F: ATGAGGCTGCGGGGATG |
NM_024830.5 |
GAPDH | F: GGTGGTCTCCTCTGACTTCAACA |
NM_002046 |
Universal Adaptor primer | GCGAGCACAGAATTAATACGAC | |
RNU6B | F: CTCGCTTCGGCAGCACA | NG_034215.1 |
hsa-miR-21-5p | F: GCAGTAGCTTATCAGACTGATG | MIMAT0000076 |
hsa-miR-23a-3p | F: AGATCACATTGCCAGGGAT | MIMAT0000078 |
hsa-miR-1246 | F: CGCAGAATGGATTTTTGGAG | MIMAT0005898 |
hsa-miR-92a-3p | F: CGCAGTATTGCACTTGTC | MIMAT0000092 |
Cel-miR-9-3p | F: GTCACCGGGTGTAAATCAG | MIMAT0000010 |