#These authors contributed to the work equally
LncRNA DLX6-AS1 has been uncovered to exert effects on various cancers. Nevertheless, the impacts of DLX6-AS1 on endometrial cancer (EC) development remained obscure. The study explored the influence of DLX6-AS1 on EC progression via the microRNA (miR)-374a-3p/zinc-finger protein (ZFX) axis.
EC cell lines were collected and DLX6-AS1, miR-374a-3p, and ZFX levels in EC cell lines were detected. The EC cells were transfected with DLX6-AS1, miR-374a-3p, and ZFX constructs to examine the biological functions of EC cells. The xenograft model was established for detecting tumor growth. Rescue experiments were conducted to verify the interaction of DLX6-AS1, miR-374a-3p, and ZFX in EC cells.
DLX6-AS1 and ZFX levels were elevated, while miR-374a-3p exhibited a reduced level in EC cells. Silencing DLX6-AS1 and elevated miR-374a-3p expressions repressed the biological activities of EC cells. Reduced DLX6-AS1 repressed tumor development. MiR-374a-3p silencing reversed the impacts of DLX6-AS1 silencing, while ZFX overexpression abrogated the impacts of miR-374a-3p elevation on EC cell growth. Mechanically, DLX6-AS1 was found to bind to miR-374a-3p, and miR-374a-3p targeted ZFX.
DLX6-AS1 depletion restricts the malignant phenotype of EC cells. The study might provide novel therapeutic biomarkers for EC treatment.
Endometrial cancer (EC) is a common gynecological cancer, and its rates continue to rise worldwide (
Long noncoding RNAs (lncRNAs) have been found to exert fundamental impacts on human tumorigenesis and development. DLX6-AS1 is a novel lncRNA that affects the progression of multiple cancers (
The operations of the animal protocol were ratified by the Institutional Animal Care and Use Committee of The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University (approval number: 20200815). Animal experiments were in full compliance with local, national, ethical, and regulatory principles and local licensing arrangements.
Human endometrial endothelial cells (hEEC) and EC cell lines (HEC-1-B, AN3-CA, KLE, HEC1-A, and Ishikawa) were provided by American Type Culture Collection (Manassas, USA). DMEM (Sigma-Aldrich, St Louis, MO, USA) added with 10% fetal bovine serum (FBS, Sigma-Aldrich, St Louis, MO, USA) was adopted for cell culture (
In Ishikawa cells, short hairpin RNA (sh-DLX6-AS1) and sh-NC were offered by Shanghai Integrated Biotechnology Solutions, Ltd. (Shanghai, China). MiR-374a-3p mimic, miR-374a-3p inhibitor, and their corresponding NCs were offered by RiboBio (Guangzhou, China); (
The groups were: sh-NC group, sh-DLX6-AS1 group, sh-DLX6-AS1 + inhibitor NC group, sh-DLX6-AS1 + miR-374a-3p inhibitor, mimic NC group, miR-374a-3p mimic group, miR-374a-3p mimic + pcDNA3.1 group, and miR-374a-3p mimic + pcDNA3.1-ZFX group.
Ishikawa cells (3 × 103 cells/well) were incubated in 96-well culture plates for 0, 24, 48, and 72 h and incubated with MTT solution for 4 h. Then, dimethyl sulfoxide (DMSO) was appended, and cells were resuspended until the crystals were completely dissolved. Lastly, the optical density value was measured at 490 nm.
Cell migration and invasion capabilities were tested through the transwell assay in the presence or absence of Matrigel (Corning Incorporated, Corning, NY, USA). Cells were fixed by serum-free medium and incubation in the upward chamber, and DMEM with 10% FBS was filled into the bottom chamber. After hot water immersion for 24-h, cells were fixed to the bottom of the upward chamber, followed by ethanol treatment and 0.1% crystalline violet staining. A microscope was adopted for counting (
Cells were lysed using RIP buffer supplemented with RNAase inhibitors. The cell lysates were subjected to incubation with Protein A/G magnetic agarose beads (Thermo Fisher Scientific, Waltham, MA, USA) pre-coated with anti-Ago2 (Bio-Rad, Hercules, CA, USA) and anti-IgG (Abcam, Cambridge, UK) as the NC. Beads were harvested, and bound RNA was extracted to measure the levels of miR-374a-3p and ZFX mRNA (
The DLX6-AS1 binding site to miR-374a-3p was queried by the RNA22 website. The TargetScan was implemented to detect the binding site of ZFX to miR-374a-3p. The miR-374a-3p binding sequence of DLX6-AS1 or ZFX was amplified and inserted into the pGL3 luciferase reporter vector. The recombinant vectors were called DLX6-AS1 wild type (DLX6-AS1-WT) or ZFX-WT. After that, the mutant binding site matching miR-374a-3p of DLX6-AS1 or ZFX was cloned into the pGL3 luciferase reporter vector to generate DLX6-AS1-mutant (MUT) or ZFX-MUT. Ishikawa cells were transfected with the above plasmids (mimic NC and miR-374a-3p mimic), and after 48-h, luciferase activity was determined in different groups by a dual luciferase reporter gene assay system (
RNA was isolated with Trizol reagent (Life Technologies, Carlsbad, CA, USA). Complementary DNA (cDNA) was synthesized with PrimeScript RT master mix kit (Takara, Dalian, China) together with All-in-OneTM miRNA First strand cDNA Synthesis Kit (GeneCopoeia, Rockville, MD, USA). RT-qPCR reactions were conducted using a SYBR Premix Ex Taq II Kit (Takara) along with a CFX96 real-time PCR detection system (Bio-Rad Laboratories, Hercules, CA, USA). Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and U6 served as internal references in this study. All the used primers are listed in
Proteins were subjected to denaturation in sample buffer spiked with protease inhibitor mixture, SDS-polyacrylamide gel electrophoresis, followed by transfer to nitrocellulose membranes. The membranes were treated with 1-h blocking with 5% milk and overnight immunoblotting with the primary antibodies (ZFX antibody: 1:1000; GAPDH antibody: 1:2000 (both Santa Cruz Biotechnology Inc., Santa Cruz, CA, USA) at 4°C. The membranes were subjected to 1-h of incubation with a corresponding secondary antibody (1:3000; Solarbio, Beijing, China). Western blots were visualized and quantified (
Female BALB/c nude mice were housed at 24 ± 1°C, 50% humidity, 12-h light-dark cycle, with water and food supply. Ishikawa cells infected with lentivirus containing DLX6-AS1 shRNA, ZGX shRNA, or corresponding negative control (NC) lentivirus. After one-week of acclimation, mice were randomly classified into four groups (n = 6/group): sh-DLX6-AS1 group, sh-NC group, sh-ZFX group, and sh-CTR group. Then, 1 × 107 cells stably expressing sh-DLX6-AS1, sh-NC, sh-ZFX, and sh-CTR were injected subcutaneously into the dorsal belly. Tumor volume was calculated every 7 d for 35 d using the formula [volume = (π × length × width2)/6]. All animals were euthanized, and tumor xenografts were obtained and weighed (
All groups of tumor tissues were dehydrated, paraffin-embedded, and sectioned (4 μm). The tissue sections were pre-treated in a microwave oven for 20 min and then incubated with 3% H2O2 for 30 min to block the endogenous peroxidase activity in the sections. Next, the sections were incubated at room temperature with primary antibody against Ki-67 (1 μg/mL, ab15580, Abcam, Cambridge, UK) and Cleaved-caspase-3 (1:200, Cell Signaling Technology, Danvers, MA, USA) for 15 min and subsequently treated with the corresponding secondary antibody (1:2000, ab205718, Abcam, Cambridge, UK) for 30 min at room temperature. After that, the sections were developed with DAB (3,3’-diaminoben-zidine) solution (P0203, Beyotime, Shanghai, China) for 10 min, then counterstained with hematoxylin staining solution (C0107, Beyotime), followed by DPX blocking, and photographing under a microscope. The positive expression rates of Ki-67 and cleaved-caspase-3 in various tumor tissues were also calculated (
The SPSS 21.0 (SPSS, Inc., NY, USA) was implemented for data analysis. The
The determination of DLX6-AS1 and miR-374a-3p levels in EC cell lines disclosed that DLX6-AS1 levels were high in EC cells (
The starBase revealed the binding sites of DLX6-AS1 and miR-374a-3p (
To determine any correlation between DLX6-AS1 and miR-374a-3p levels with EC cell progression, Ishikawa cells were further treated, and the DLX6-AS1 and miR-374a-3p levels reflected reduced DLX6-AS1 expression after transfection with sh-DLX6-AS1 and sh-DLX6-AS1 + anti-miR-374a-3p (
ZFX level is elevated in EC (
To probe whether miR-374a-3p regulated EC cell progression by targeting ZFX, we first examined miR-374a-3p and ZFX levels in EC cells upon further treatment with miR-374a-3p mimic and ZFX augmentation. The results revealed that miR-374a-3p levels were enhanced, while ZFX expression was reduced after miR-374a-3p mimic treatment (
We then examined the ZFX levels by western blotting after further treatment. Inhibition of DLX6-AS1 decreased ZFX levels, while miR-374a-3p silencing reversed the impacts of silencing DLX6-AS1 on reducing ZFX levels; miR-374a-3p elevation reduced ZFX levels, and ZFX overexpression could reverse the impacts of miR-374a-3p elevation on reducing ZFX levels (
A xenograft tumor model was constructed to address the impacts of DLX6-AS1 and ZFX
Although patients with EC have a good prognosis at an early stage, the high-grade patients suffer greatly. Besides, although several new drugs have been tested, the results remained gloomy, and no effective targeted agents have been approved (
As previously described, DLX6-AS1 affects the modulation of multiple cancers. Hui
Thereafter, the binding relation between DLX6-AS1 and miR-374a-3p was predicted by the bioinformatics websites. MiR-374a-3p has been validated to be depleted in different cancers and play an antitumor role. For example, the miR-374a-3p level is depleted in NSCLC, and increased miR-374a-3p attenuates the development of NSCLC (
We then hypothesized that miR-374a-3p had binding sites with ZFX.
To conclude, our study demonstrates that DLX6-AS1 and ZFX levels are increased in EC cells, while the level of miR-374a-3p was low in EC cells. Functionally, DLX6-AS1 silencing caused repression of biological activities of EC cells through the modulation of the miR-374a-3p/ZFX axis. This work underlines the modulating mechanism of the DLX6-AS1/miR-374a-3p/ZFX axis in EC progression and aids in developing novel biomarkers, new interventions, and treatment for EC, thus exploring underlying therapeutic strategies of EC. Nevertheless, more studies are warranted to further unveil the function of the downstream regulatory factors of DLX6-AS1 in EC. Meanwhile, it would be significant to discuss antitumor drug tolerance effects in terms of the DLX6-AS1/miR-374a-3p/ZFX axis. From the therapeutic angle, it is significant to deliver the lentivirus/drug into the (wild-type) tumor to examine the effects of DLX6-AS1 knockdown on tumor growth.
This work was supported by
Wei Shi contributed to study design; Yan Liang contributed to manuscript editing; Jianxia Lin and Xianjing Xie contributed to experimental studies; Rong Jin contributed to data analysis. All authors read and approved the final manuscript.
The datasets generated during and/or analyzed during the current study are available from the corresponding author on reasonable request.
The operations of the animal protocol were ratified by the Institutional Animal Care and Use Committee of The International Peace Maternity and Child Health Hospital, School of Medicine, Shanghai Jiao Tong University (approval number: 20200815). Animal experiments were in full compliance with local, national, ethical, and regulatory principles and local licensing arrangements.
The authors declare that they have no conflicts of interest to report regarding the present study.
Primer name | Sequences (5′-3′) |
---|---|
DLX6-AS1-F | GGATTCTGTGTGGGGTTGGAA |
DLX6-AS1-R | GATCATGGGAGCACTCAGCC |
miR-374a-3p-F | CTTATCAGATTGTATTGTAATT |
ZFX-F | GGCAGTCCACAGCAAGAAC |
ZFX-R | TTGGTATCCGAGAAAGTCAGAAG |
GAPDH-F | AACGTGTCAGTGGTGGACCTG |
GAPDH-R | AGTGGGTGTCGCTGTTGAAGT |
U6-F | ATTGGAACGATACAGAGAAGATT |
U6-R | GGAACGCTTCACGAATTTG |
Note: F, forward; R, reverse; DLX6-AS1, distal-less homeobox 6 antisense 1; miR-374a-3p, microRNA-374a-3p; GAPDH, glyceraldehyde-3-phosphate dehydrogenase.