Mycorrhizas Affect Polyphyllin Accumulation of Paris polyphylla var. yunnanensis through Promoting PpSE Expression

Hailing Li; Lingfeng Xu; Zhuowei Li; Shunxin Zhao; Dongqin Guo; Lu Rui; Nong Zhou

doi:10.32604/phyton.2021.015697

Hailing Li1,2, Lingfeng Xu1, Zhuowei Li1, Shunxin Zhao1, Dongqin Guo1, Lu Rui1,*and Nong Zhou1,*

1Chongqing Engineering Laboratory of Green Planting and Deep Processing of Famous-Region Drug in the Three Gorges Reservoir Region, College of Biology and Food Engineering, Chongqing Three Gorges University, Chongqing, 404120, China
2College of Pharmaceutical Sciences, Dali University, Dali, 671000, China
*Corresponding Authors: Lu Rui. Email: ruilu1986@163.com; Nong Zhou. Email: erhaizn@126.com
Received: 07 January 2021; Accepted: 20 February 2021

Medicinal plants are valuable natural resources with health owing to their biological activity [1]. Because the huge medicinal and economic values, people paid great concern about medicinal plants recently. Besides their medicinal usage, medicinal plants are served as food supplements, herbal teas and health care products for their benefits to human health.

Paris polyphylla var. yunnanensis is a perennial herb belonging to Liliaceae, whose dried rhizomes are widely used in the Traditional Chinese Medicine (TCM) [2]. The plant mainly distributes in tropical or cold temperate areas throughout Europe and Eastern Asia. Guizhou Province, Yunnan Province and Sichuan Province are primary distribution areas in China. Additionally, P. polyphylla var. yunnanensis is one of the original plants of Paris polyphylla recorded in 2020 edition of Chinese Pharmacopoeia [3]. The dry rhizome of the plant is used as medicine, which has effects on hemostasis, detoxification, detumescence and pain relief, and is used in antitumor and antimicrobial treatments [4–6]. P. polyphylla var. yunnanensis has high medicinal and economic value as a main raw material of traditional Chinese patent medicines such as “Yunnan Baiyao” and “Gongxuening Capsule” [7]. However, habitat loss, slow growth and over-exploitation result in its wild resources to be endangered. P. polyphylla has been listed as national level II protected plants (http://rep.iplant.cn/). Therefore, it is particularly important to increase the production and the content of the main active ingredients of P. polyphylla var. yunnanensis.

P. polyphylla var. yunnanensis contains hundreds of active components such as steroidal saponins, phytosterols, flavonoids, and fatty acid ester, etc. Polyphyllin is one of the main medicinal ingredients belonging to steroidal saponins [8,9]. Polyphyllin I exhibits anticancer properties in prostate cancer, gastric cancer and ovarian cancer [10–12]. Polyphyllin II exerts a significant effect on anti-lung adenocarcinoma and anti-hepatocellular carcinoma [13,14]. Polyphyllin VII shows its activity on inducing apoptotic cell death in lung cancer cells and inhibiting reactive oxygen species production in osteoclast to attenuate its differentiation [15–17]. In addition, polyphyllin VII displays special anti-inflammatory effects in vitro and in vivo [18].

The biosynthesis of steroidal saponins in plants relies on both cytosolic mevalonate (MVA) pathway and plastidial methylerythritol-4-phosphate (MEP) pathway [19]. Although the initial chemicals in the two pathways are different, both pathways lead to the formation of iso-amyl pyrophosphate (IPP), then isomerizes into dimethylallyl diphosphate (DMAPP), which provides the backbones of steroidal aglycone [20]. The 3-hydroxy-3-methylglutaryl CoA reductase (HMGR) is a crucial regulator, catalyzing the conversion of 3-hydroxy-3-methyl-glutaryl-CoA into mevalonate which is an irreversible and rate limiting step. The expression level of HMGR directly affects the content of steroidal saponin compounds [21,22]. HMGR was identified in various model and economic plants such as Arabidopsis [23], wheat [24], rice [25], coffee [26], etc., and characterized in numerous traditional Chinese medicinal materials like Ginkgo biloba [27], Salvia miltiorrhiza [28], Paris fargesii Franch [29] and Panax ginseng [30]. After IPP and DMAPP formation, DMAPP is catalyzed to synthesize squalene via geranyl diphosphate synthase (GPS), farnesyl diphosphate synthase (FPS) and squalene synthase (SQS). Squalene is subsequently converted into 2, 3-oxidosqualene under the catalytic activity of squalene epoxidase which determines the biosynthesis rate of 2, 3-oxidosqualene to a great extent, and affects the synthesis of steroidal saponins [19].

Arbuscular mycorrhizal fungi (AMF) are widespread beneficial soil microorganisms establishing interactions with more than 80% of vascular plants. During the interaction between AMF and plant roots, a symbiotic relationship is formed. AMF provide nutrition for plant roots derived from soil in exchange for sugar or other organic carbon sources [31]. It was demonstrated that plants symbiotic with AMF have improved survival rate after planting and increased production [32]. AMF also promote the absorption of water and mineral nutrients by host plants, elevating stress resistance, affecting the production of secondary metabolites of medicinal plants [33]. What’s more, they improve the quality of soil and are favorable to the environment. Although numerous researches have been carried out the interaction between AMF and different host plants, including many medicinal plants, little was known about the effects on P. polyphylla var. yunnanensis after AMF inoculation. In this study we analyzed the change in polyphyllin contents of P. polyphylla var. yunnanensis and the expression level of PpSE and PpHMGR after AMF inoculation.

One wild variety and one cultivated variety were planted separately in two different resources base that both located in Xixiu district, Anshun City, Guizhou Province, China. The seeds of the wild variety and the cultivated variety were harvested in October 2013 from one-year-old plants of P. polyphylla var. yunnanensis separately. All samples were stored in sand at room temperature for almost 4 months and were then identified. After removing the exocarp, the seeds were washed with distilled water and soaked in 10% NaClO for 15 min. And then seeds were washed with distilled water again to eliminate NaClO. Cultivation substrate was a mixture of vegetable garden soil and sand (soil:sand = 3:1, and was sterilized at 121°C for 2 h). Ten groups (9 AMF species inoculation groups and 1 control group) were set up with 10 replicates in each group. Fresh seeds from the cultivated and the wild variety of P. polyphylla var. yunnanensis were mixed with AMF in January 2014. Hoagland solutions were regularly watered during the growth of seedlings.

AMF were purchased from the International Arbuscular Mycorrhizal Fungi Collection (INVAM). Mycorrhizal fungal inoculum contained cultivation substrates with spores, hyphae and infected root segments. At transplanting time, AMF inoculums were applied into the pots. A total of ten treatments were laid, as shown in Tab. 1.

The polyphyllin I, II, and VII in P. polyphylla var. yunnanensis was extracted according to the first volume of Chinese pharmacopoeia in 2020 and determined using a HPLC assay described by Zhou et al. [34] previously.

Total RNA was extracted with 0.1 g per sample using SGTriEx high purity total RNA extraction kit following the manufacturer’s instruction. A total of 5 μg RNA were subjected to first strand of cDNA synthesis.

Analysis of gene expression were performed as described previously by Wang et al. [35]. The qRT-PCR data were subjected to standard statistical analysis. Primers of genes used in this study are: PpSE-F: ATGTCCCTGGTCAGAAGGTG, PpSE-R: AGTTATCTCCAAGTCGATCAGTT, PpHMGR-F: GGCAGTGCTGCGAGATGCC, PpHMGR-R: CTTGCAGCCCCTATTGGTG PpCCaMK-F: GCCGTCGCCGTTGGCGTC, PpCCaMK-R: GCCGTCGCCGTTGGCGTC and PpActin-F: TCCATCATGAAGTGTGATGT, PpActin-F: AGTGATCTCCTTGCTCATAC.

The figures were generated using Microsoft Excel and Adobe illustrator software. Statistical analysis was performed using the SPSS 20.0 and GraphPad Prism 4 software.

The AMF used in our trials were listed in Tab. 1. As described in details by Zhou et al. [34], AMF in our study successfully established mycorrhizal symbioses with P. polyphylla var. yunnanensis plants, showing percentages of colonized root length ranging from 91.29%~100.00%. The naturally occurring AMF showed lower mycorrhizal percentages, which ranged from 36.41%~83.7% [36]. The average intensity of the mycorrhizal colonization in the root system was 55.35%, indicating AMF had a good symbiotic relationship with P. polyphylla var. yunnanensis seedlings. However, the significant difference of colonization percentages and intensity of mycorrhizalonisation exists only between control groups and AMF treatment groups and there were no statistical differences among the treatments. Moreover, compared with the uninoculated plants, the ALP and SDH activities of mycorrhizal were enhanced, indicating that the biological activities of mycorrhizal fungi were also improved. Mycorrhization was reported to promote plant growth however its impact on P. polyphylla var. yunnanensis was not fully understood. In our previous study, applying of AMF altered the content of carotenoid, chlorophyll A and chlorophyll B and slightly increased the biomass of the plants [37].

3.2 AMF Improved Polyphyllin Content Level in P. Polyphylla var. Yunnanensis with Different Efficiency

Total polyphyllin was shown in Fig. 1. Overall, the results showed that except for some AMF treatment groups (S1 after 7 months of colonization, S2 after 19 months of colonization), mycorrhiza-based inoculation increased the total polyphyllin content in inoculated group either at 7 months post inoculation (MPI) or 19MPI, indicating AMF extensively improved polyphyllin accumulation (Fig. 1). However, the effects of different mixture of fungi species were greatly different, the applied AMF had an impact on the content of total polyphyllin, which was significantly enhanced in the plants colonized with S5 to S9 after 7 months comparing to the S1 to S4 inoculation. After 19 months of planting, polyphyllin at basal level decreased which may due to maturation of plants and reduction of biosynthesis of saponin. It revealed that after 7 months growth, polyphyllin level was relatively low in plants colonized by S1, whereas plants colonized by S1 after 19 months had a significantly higher polyphyllin content. The species in group S2 had the opposite effect to S1 on polyphyllin, suggesting the species in S2 group played an important role mainly within 7 months while after long period of AMF colonization the strains in S1 group were important factors to regulate polyphyllin accumulation.

Figure 1: Total polyphyllin content in P. polyphylla var. yunnanensis after AMF inoculation in wild and cultivated varieties in different time and culturing environment

To further investigate AMF effect on different varieties, we compared polyphyllin content level in the wild and cultivated varieties after 7 months of mycorrhization. As was shown in Fig. 1, plants had similar polyphyllin levels regardless of uninoculated group or S3 and S4 treatment. Fungi species in S5 to S9 groups also improved polyphyllin accumulation with higher efficiency which was consistent with that in the cultivated variety. Polyphyllin concentration was much significantly elevated in the cultivated plants than the wild variety after S5, S6 and S9 inoculation, indicating the fungi in these groups were much fitter for the cultivated variety. In addition, the level of polyphyllin was not significantly increased after inoculated with S4 regardless of the time of colonization, plant varieties or planting environments.

Basal polyphyllin level in the cultivated variety planted in the field after 7 months of AMF colonization was remarkably higher than that grew in the chamber, which may be caused by the presence of AMF in the soil and environment. This is not surprising as AMF occur naturally in field soils. Similarly, plants colonized by AMF had significantly higher polyphyllin concentrations except S4, S8 and S9 treatment. Specifically, S6 treatment still highly induced the accumulation of polyphyllin whereas the induction effect of the fungi in S5 were not as obvious as that in the chamber. To our surprise, the least efficient AMF strains in stimulating polyphyllin performance in the chamber were S1 and S2 which had a good induction ability in the fields. Our results suggested that in the fields, mycorrhizal fungi in group S1, S2, and S6 established a good symbiotic relationship with P. polyphylla var. yunnanensis and improved the mycorrhizal and polyphyllin content of the plant. Taken together, we assessed the effects of AMF on P. polyphylla var. yunnanensis and found applied fungi in S5, S6 and S7 improved the content of polyphyllin regardless of plant varieties, inoculation time or planting environments.

Polyphyllin I (PPI), polyphyllin II (PPII) and polyphyllin VII (PPVII) are three of the primary active components isolated from rhizoma of P. polyphylla, which had different concentration and biological activity. In the chamber, both in the cultivated and wild varieties, PPVII level was highest, followed by PPI and PPII (Fig. 2). However, in the fields, the proportion of PPVII and PPI was decreased with increased PPII, suggesting planting environment affected the accumulation of different active components of polyphyllin.

Figure 2: The percentage of PPI, PPII and PPVII in P. polyphylla var. yunnanensis after AMF inoculation was illustrated in the form of pie chart

We further analyzed the effect of AMF on different components of polyphyllin, As shown in Fig. 3A, after 7 months, PPI was dramatically increased both in the cultivated and wild varieties after S9 colonization. After 19 months, out of nine AMF groups tested, S4 increased PPI most efficiently, followed by S9. In the comparison between the cultivated and wild varieties, The PPI of P. polyphylla var. yunnanensis seedlings were found to be significantly higher in the wild plants grown in soil inoculated with AMF in S7 and S8 group. The seedlings cultured in the presence of AMF in group S1, S2 and S6 showed the highest increasement of PPI in the plant rhizome, followed by AMF application in group S3, S4 and S5.

Figure 3: PPI (A) and PPII (B) levels after AMF inoculation in wild and cultivated varieties in different time and culturing conditions

S5, S6, S7, S8 and S9 mycorrhization had positive impact on the content of PPII at 7MPI, among which was especially pronounced in the differences found in the plants colonized with S6 (Fig. 3B). After 19 months, with the extension of inoculation time, most groups inoculated with AMF had not significantly increase the content of PPII, except for AMF in S1 and S9 group. It was revealed in Fig. 3B that introducing AMF inoculants were not remarkably increase PPII in wild plants. Additionally, PPII was significantly accumulated after S2 inoculation in the fields. Above all, P. polyphylla var. yunnanensis inoculated with AM inoculum resulted in an increased beneficial effect on accumulation of PPI and PPII depending on AM stains, inoculation time, plant varieties and environments.

3.4 Quantitively Real Time PCR Analyze of PpSE and PpHMGR in P. polyphylla var. yunnanensis after AMF Inoculation

Intensity of mycorrhizalonisation in the root system is one of the most important factors to determine plant biomass and secondary metabolism rate. We evaluated the correlation between intensity of mycorrhizalonisation and polyphyllin level in the plants after 7 months. As revealed in Fig. 4A, AMF in S6 significantly increased the content of polyphyllin with low inoculation intensity, suggesting the inoculation intensity was not strongly correlated with polyphyllin content level in P. polyphylla var. yunnanensis. Similar results were shown in Figs. 4B and 4D. The correlation between mycorrhizalonisation intensity and polyphyllin content was not affected by increasing inoculation time or changing planting environments. It is interesting that in the wild variety, the correlation was significantly enhanced (Fig. 4C). Overall, AMF increased the content of polyphyllin in the cultivated variety with low relation to the increase of mycorrhizalonisation intensity.

Figure 4: Intensity of mycorrhizalonisation in the root system and polyphyllin content after AMF inoculation at 7MPI (A), 19MPI (B), the wild variety (C) and in the field (D)

HMGR and SE are two rate limiting enzymes in steroidal saponins biosynthesis in plants. To further investigate the mechanism underling polyphyllin accumulation and the relationship to polyphyllin biosynthesis after AMF colonization. We detected the PpSE and PpHMGR transcripts by quantitively real time PCR analysis. After 7 months, PpSE was up-regulated by AMF regardless of strains (Fig. 5A). The expression levels of PpSE were also significantly up-regulated in the plants colonized by S1, S3, S4, S6, S7, S8 after 19 months. Prior to inoculation, PpSE transcriptional level was rather low in both varieties. Upon inoculation with AMF, PpSE transcripts accumulated at higher levels in cultivated plants than in wild plants, which was consistent with polyphyllin content level. PpSE expression level was remarkably up-regulated by S2 and S8 in the fields.

Figure 5: Relative expression level of PpSE (A) and PpHMGR (B) in P. polyphylla var. yunnanensis after AMF inoculation in wild and cultivated varieties in different time and culturing conditions

We also examined expression level of PpHMGR, the relative transcriptional level of this gene was lower in CK group, unlike PpSE, PpHMGR transcripts were not extensively affected by mycorrhizas (Fig. 5B). PpHMGR transcriptional level in S8, S6, S5 AFM-inoculated plants was markedly higher than in control plants at 7MPI, 19MPI and in the wild variety, respectively. These results demonstrated that the transcriptional level of the PpSE gene has higher correlation with the content of polyphyllin content of P. polyphylla var. yunnanensis, suggesting up-regulating of PpSE led to polyphyllin content accumulation after mycorrhization (Fig. 6). CCaMK gene encodes a calcium and calmodulin-dependent protein kinase that is necessary for the establishment of both rhizobial and mycorrhizal symbioses, hence PpCCaMK was used as a negative control. There was no significant different of the expression level of PpCCaMK among different treatment groups (Fig. 6).

Figure 6: Relationship between polyphyllin content and the expression level of PpSE, PpHMGR and PpCCaMK after different AMF inoculation in cultivated P. polyphylla var. yunnanensis

AMF are most ubiquitously existent and of ancient origin which establish symbioses with the roots of almost all groups of land plants, with 80% of species forming these associations. The AMF-plant symbioses were found to contribute to various biological process in host plants, including improving biomass, enhancing tolerance to biotic and abiotic stress, increasing mineral uptake and stimulating photosynthesis as well as influencing secondary metabolism in plants [38,39]. Therefore, AMF are proposed to be used in agriculture to improve the yield and quality of crops and medicinal plant species [40]. AMF were found to improve plant growth in tomato [41], orange [42], maize [43], yam [44], mulberry and papaya [45], confirming that AMF possess a considerable potential for enhancing crop yield. In the impact of secondary metabolism, AMF-colonized strawberry [46] and tomato [41] exhibited beneficial effects on increased levels of secondary metabolites resulting in quality improvement. Although much has been done about the effects of AMF on plant yield, stress and secondary metabolism, little was known about the effects of AMF on polyphyllin content accumulation in P. polyphylla var. yunnanensis [47]. Until recently, few investigations focused on AM effects on the production of polyphyllin in P. polyphylla var. yunnanensis plants. In the present study, we demonstrated that AMF established a well symbiotic relationship with roots of P. polyphylla var. yunnanensis, showing high intensity of mycorrhizal colonization in the root system (Fig. 4). Total and three main active polyphyllin components were successfully obtained from the plants after mycorrhization at two time points, two plant varieties and two planting environments. And we reported to the best of our knowledge for the first time, AMF was found to influence the contents of total polyphyllin (Fig. 2), polyphyllin I, polyphyllin II and polyphyllin VII (Fig. 3). AMF increased the content of polyphyllin in the cultivated variety with low relation to the increase of inoculation intensity. Polyphyllin I, II, and VII were identified and partly improved by AMF inoculation, dependent on AMF treatments and culture environments. The variability of polyphyllin concentrations we observed in plants colonized by different AMF highlighted the functional diversity that existed between fungal isolates (Figs. 1 and 3). There are also researches indicating variations in effectiveness of different AMF species in the production of active compounds [48,49]. Additional, Our data revealed that S5, S6 and S7 mycorrhizal fungi are key organisms that can be beneficial in the development of strong and healthy plants with reasonable polyphyllin level (Figs. 1 and 3). And it would be better to collect the plant tissues after 7 months of mycorrhization to obtain higher content of total polyphyllin (Fig. 1). Our results provide a theoretical basis for the application of AMF in enhancing the content of polyphyllin in P. polyphylla var. yunnanensis.

The mechanism how AMF trigger changes in polyphyllin concentration in plant might be multidirectional and is remain unclear. Some studies suggest that the essential pathway for the synthesis of steroidal saponins is the known mevalonate pathway, in which SE is one of the key rate-limiting enzymes. Regulating the biological activity of SE enzyme can directly affect the biosynthesis of squalene epoxide, and then affect the production of various steroidal saponins.

Squalene epoxidase were studied in many plants, such as Panax notoginseng [30], Gynostemma pentaphyllum [50] and Betula platyphylla [51]. In addition, also a key rate-limiting enzyme, HMGR, is suggested to be a regulatory factor during steroidal saponins biosynthesis. It was reported that HMGR is the key enzyme and regulator of mevalonate pathway (MVA) in medicinal plants. The HMGR gene was studied in many plants, such as Aquilaria sinensis [52], Glycyrrhiza [53] and Salvia miltiorrhiza [28]. Understanding of the expression level of these two key enzyme genes in the biosynthesis pathway of steroidal saponins would provide a theoretical foundation for enhancing the content of effective medicinal ingredients in precious or endangered medicinal plants by manipulating biological process using molecular biological technology. In our study, the expression levels of both PpSE and PpHMGR contributed to the accumulation of polyphyllin (Fig. 5), in which the PpSE expression and the polyphyllin content had a higher correlation (Fig. 6), suggesting PpHMGR, PpSE played a crucial role of polyphyllin biosynthesis in P. polyphylla var. yunnanensis. Up-regulating of PpSE is one of the mechanisms underlying polyphyllin increasement, meaning P. polyphylla var. yunnanensis has established a symbiotic relationship with AMF to regulate the expression of PpSE, and further affects the level of polyphyllin. More work is needed to elucidate the mechanisms of how the PpSE specifically regulates polyphyllin accumulation.

Funding Statement: This work was supported by the National Natural Science Foundation of China (No. 81260622) and Chongqing Natural Science Foundation Project (cstc2018jcyjAX0267).

Conflicts of Interest: The authors declare that they have no conflict of interest.

References

Wang, Y., Li, Y., & Zhang, J. (2019). Capturing the geoherbalism differentiation in wild var. raw materials through the application of multispectral information fusion combined with chemometrics. ACS Omega, 4(20), 18820-18832. [Google Scholar] [CrossRef]
Bergman, M. E., Davis, B., & Phillips, M. A. (2019). Medically useful plant terpenoids: Biosynthesis, occurrence, and mechanism of action. Molecules, 24(21), 3961. [Google Scholar] [CrossRef]
National Pharmacopoeia Commission ( 2020). Pharmacopoeia of PR China. vol. I, 271.
Yu, K., Fan, Q., Wang, Y., Wei, J., & Ma, Q. (2013). Function of leafy sepals in : photosynthate allocation and partitioning to the fruit and rhizome. Functional Plant Biology, 40(4), 393-399. [Google Scholar] [CrossRef]
Zhao, J., Mou, Y., Shan, T., Li, Y., & Zhou, L. (2010). Antimicrobial metabolites from the endophytic fungus isolated from var. . Molecules, 15(11), 7961-7970. [Google Scholar] [CrossRef]
Liu, Z., Li, N., Gao, W., Man, S., & Yin, S. (2012). Comparative study on hemostatic, cytotoxic and hemolytic activities of different species of . Journal of Ethnopharmacology, 142(3), 789-794. [Google Scholar] [CrossRef]
Qin, X. J., Ni, W., Chen, C. X., & Liu, H. Y. (2018). Seeing the light: Shifting from wild rhizomes to extraction of active ingredients from above-ground parts of var. . Journal of Ethnopharmacology, 224, 134-139. [Google Scholar] [CrossRef]
Moses, T., Papadopoulou, K. K., & Osbourn, A. (2014). Metabolic and functional diversity of saponins, biosynthetic intermediates and semi-synthetic derivatives. Critical Reviews in Biochemistry and Molecular Biology, 49(6), 439-462. [Google Scholar] [CrossRef]
Wu, Z., Zhang, J., Xu, F., Wang, Y., & Zhang, J. (2017). Rapid and simple determination of polyphyllin I, in different harvest times of cultivated var. Hand.-Mazz by UPLC-MS/MS and FT-IR. Journal of Natural Medicine, 71(1), 139-147. [Google Scholar] [CrossRef]
Zhang, D., Liu, S., Liu, Z., Ma, C., & Jiang, Y. (2019). Polyphyllin I induces cell cycle arrest in prostate cancer cells via the upregulation of IL6 and P21 expression. Medicine, 98(44), e17743. [Google Scholar] [CrossRef]
Zhang, Y., Huang, P., Liu, X., Xiang, Y., & Zhang, T. (2018). Polyphyllin I inhibits growth and invasion of cisplatin-resistant gastric cancer cells by partially inhibiting CIP2A/PP2A/Akt signaling axis. Journal of Pharmacological Science, 137(3), 305-312. [Google Scholar] [CrossRef]
Gu, L., Feng, J., Zheng, Z., Xu, H., & Yu, W. (2016). Polyphyllin I inhibits the growth of ovarian cancer cells in nude mice. Oncology Letters, 12(6), 4969-4974. [Google Scholar] [CrossRef]
Niu, W., Xu, L., Li, J., Zhai, Y., & Sun, Z. (2020). Polyphyllin II inhibits human bladder cancer migration and invasion by regulating EMT-associated factors and MMPs. Oncology Letters, 20(3), 2928-2936. [Google Scholar] [CrossRef]
Pang, D., Yang, C., Li, C., Zou, Y., & Feng, B. (2020). Polyphyllin II inhibits liver cancer cell proliferation, migration and invasion through downregulated cofilin activity and the AKT/NF-κB pathway. Biology Open, 9(2), bio046854. [Google Scholar] [CrossRef]
He, H., Xu, C., Zheng, L., Wang, K., & Jin, M. (2020). Polyphyllin VII induces apoptotic cell death via inhibition of the PI3K/Akt and NF-κB pathways in A549 human lung cancer cells. Molecular Medicine Reports, 21(2), 597-606. [Google Scholar]
Wang, H., Fei, Z., & Jiang, H. (2017). Polyphyllin VII increases sensitivity to gefitinib by modulating the elevation of P21 in acquired gefitinib resistant non-small cell lung cancer. Journal of Pharmacological Science, 134(3), 190-196. [Google Scholar] [CrossRef]
Zhou, L., Song, H., Zhang, Y., Ren, Z., & Li, M. (2020). Polyphyllin VII attenuated RANKL-induced osteoclast differentiation via inhibiting of TRAF6/c-Src/PI3K pathway and ROS production. BMC Musculoskeletal Disorders, 21(1), 136. [Google Scholar] [CrossRef]
Zhang, C., Li, C., Jia, X., Wang, K., & Tu, Y. (2019). and anti-inflammatory effects of polyphyllin VII through downregulating MAPK and NF-κB pathways. Molecules, 24(5), 875. [Google Scholar] [CrossRef]
Upadhyay, S., Jeena, G. S., Shikha, ., & Shukla, R. K. (2018). Recent advances in steroidal saponins biosynthesis and in vitro production. Planta, 248(3), 519-544. [Google Scholar] [CrossRef]
Wu, X., Wang, L., Wang, H., Dai, Y., & Ye, W. C. (2012). Steroidal saponins from var. . Phytochemistry, 81, 133-143. [Google Scholar] [CrossRef]
Vranová, E., Coman, D., & Gruissem, W. (2013). Network analysis of the MVA and MEP pathways for isoprenoid synthesis. Annual Review of Plant Biology, 64(1), 665-700. [Google Scholar] [CrossRef]
Liao, P., Wang, H., Hemmerlin, A., Nagegowda, D., & Bach, T. (2014). Past achievements, current status and future perspectives of studies on 3-hydroxy-3-methylglutaryl-CoA synthase (HMGS) in the mevalonate (MVA) pathway. Plant Cell Reports, 33(7), 1005-1022. [Google Scholar] [CrossRef]
MAsashi, S., Yukiko, K., Noriko, N., Hikaru, S., & Kiyoshi, O. (2004). Loss of function of 3-hydroxy-3-methylglutaryl coenzyme A reductase1() in leads to dwarfing, early senescence and male sterility, and reduced sterol leaves. The Plant Journal, 37(5), 750-761. [Google Scholar] [CrossRef]
Kazuko, A., Anne, B., Keith, M., Larry, F., & Tom, U. (1993). Isolation and characterization of cDNAs encoding wheat 3-hydroxy-3-methylglutaryl coenzyme a reductase. Plant Physiology, 102(2), 623-628. [Google Scholar] [CrossRef]
Ha, S. H., Lee, S. W., Kim, Y. M., & Hwang, Y. S. (2001). Molecular characterization of gene encoding a 3-hydroxy-methylglutaryl-CoA reductase in rice. Molecules and Cells, 11(3), 295-302. [Google Scholar]
Tiski, I., Marraccini, P., Pot, D., Vieira, L. G., & Pereira, L. F. (2011). Characterization and expression of two cDNA encoding 3-hydroxy-3-methylglutaryl coenzyme A reductase isoforms in coffee (.). OMICS: A Journal of Integrative Biology, 15(10), 719-727. [Google Scholar] [CrossRef]
Shen, G., Pang, Y., Wu, W., Liao, Z., & Zhao, L. (2006). Cloning and characterization of a root-specific expressing gene encoding 3-hydroxy-3-methylglutaryl coenzyme a reductase from . Molecular Biology Reports, 33(2), 117-127. [Google Scholar] [CrossRef]
Dai, Z., Cui, G., Zhou, S. F., Zhang, X., & Huang, L. (2011). Cloning and characterization of a novel a reductase gene from involved in diterpenoid tanshinone accumulation. Journal of Plant Physiology, 168(2), 148-157. [Google Scholar] [CrossRef]
Liang, Y., Jiang, X., Hu, Q., Li, X., & Yin, H. (2014). Cloning and characterization of reductase () gene from . Indian Journal of Biochemistry and Biophysics, 51(3), 201-206. [Google Scholar]
Luo, H. M., Song, J. Y., Li, X. Y., Sun, C., & Li, C. F. (2013). Cloning and expression analysis of a key device of gene involved in ginsenoside biosynthesis of via synthetic biology approach. Acta Pharmaceutica Sinica, 48, 219-227. [Google Scholar]
Wu, Q. S., He, J. D., Srivastava, A. K., Zou, Y. N., & Kuča, K. (2019). Mycorrhizas enhance drought tolerance of citrus by altering root fatty acid compositions and their saturation levels. Tree Physiology, 39(7), 1149-1158. [Google Scholar] [CrossRef]
Xie, M. M., Wang, Y., Li, Q. S., Kuča, K., & Wu, Q. S. (2020). A friendly-environmental strategy: Application of arbuscular mycorrhizal fungi to ornamental plants for plant growth and garden landscape. Nature Botany and Horticulture Agriculture, 48, 1100-1115. [Google Scholar]
Sbrana, C., Avio, L., & Giovannetti, M. (2014). Beneficial mycorrhizal symbionts affecting the production of health-promoting phytochemicals. Electrophoresis, 35(11), 1535-1546. [Google Scholar] [CrossRef]
Zhou, N., Huang, Y. P., Guo, D. Q., Zhang, J., & Yang, M. (2020). Symbiotic effects of mycorrhizal fungi and different seedling ages of var. . Journal of Traditional Chinese Medicine, 36(22), 3091-3096. [Google Scholar]
Wang, M., Rui, L., Yan, H., Shi, H., & Zhao, W. (2018). The major leaf ferredoxin Fd2 regulates plant innate immunity in . Molecular Plant Pathology, 19(6), 1377-1390. [Google Scholar] [CrossRef]
Zhang, R. Q., Lu, Z. L., Chen, J. W., Tang, X., & Zhao, H. Q. (2011). The systematical effect of the influence of AM fungus on the antioxidase activities in the roots of clover plants. Microbiology, 38(3), 322-327. [Google Scholar]
Huang, Y. P., Zhang, J., Yang, M., Ding, B., & Guo, D. X. (2019). Effects of different inoculation periods on seedling growth and steroidal saponin content of var. . Chinese Traditional and Herbal Drugs, 50(18), 4438-4448. [Google Scholar]
Emmanuel, O. C., & Babalola, O. O. (2020). Productivity and quality of horticultural crops through co-inoculation of arbuscular mycorrhizal fungi and plant growth promoting bacteria. Microbiological Research, 239(1), 126569. [Google Scholar] [CrossRef]
Ellouze, W., Esmaeili, T. A., Bainard, L. D., Yang, C., & Bazghaleh, N. (2014). Soil fungal resources in annual cropping systems and their potential for management. BioMed Research International, 2014(6129), 1-15. [Google Scholar] [CrossRef]
Avio, L., Turrini, A., Giovannetti, M., & Sbrana, C. (2018). Designing the ideotype mycorrhizal symbionts for the production of healthy food. Frontiers in Plant Science, 9, 392. [Google Scholar] [CrossRef]
Bona, E., Cantamessa, S., Massa, N., Manassero, P., & Marsano, F. (2017). Arbuscular mycorrhizal fungi and plant growth-promoting pseudomonads improve yield, quality and nutritional value of tomato: A field study. Mycorrhiza, 27(1), 1-11. [Google Scholar] [CrossRef]
Yang, L., Zou, Y. N., Tian, Z. H., Wu, Q. S., & Kuča, K. (2021). Effects of beneficial endophytic fungal inoculants on plant growth and nutrient absorption of trifoliate orange seedlings. Scientia Horticulturae, 277, 109815. [Google Scholar] [CrossRef]
Saia, S., Aissa, E., Luziatelli, F., Ruzzi, M., & Colla, G. (2020). Growth-promoting bacteria and arbuscular mycorrhizal fungi differentially benefit tomato and corn depending upon the supplied form of phosphorus. Mycorrhiza, 30(1), 133-147. [Google Scholar] [CrossRef]
Lu, F. C., Lee, C. Y., & Wang, C. L. (2015). The influence of arbuscular mycorrhizal fungi inoculation on yam (.) tuber weights and secondary metabolite content. PeerJ, 3(3), e1266. [Google Scholar] [CrossRef]
Mamatha, G., Bagyaraj, D. J., & Jaganath, S. (2002). Inoculation of field-established mulberry and papaya with arbuscular mycorrhizal fungi and a mycorrhiza helper bacterium. Mycorrhiza, 12(6), 313-316. [Google Scholar] [CrossRef]
Chen, P., Wang, Y. Z., Liu, Q. Z., Li, W. H., & Li, H. Q. (2020). Transcriptomic analysis reveals recovery strategies in strawberry roots after using a soil amendment in continuous cropping soil. BMC Plant Biology, 20(1), 869. [Google Scholar] [CrossRef]
Yang, Y., Yang, S. C., Zhao, J., Udikeri, S., & Liu, T. (2015). Microbial diversity in var. rhizomes of varying ages. Genetics and Molecular Research, 14(4), 17612-17621. [Google Scholar] [CrossRef]
Kapoor, R., Giri, B., & Mukerji, K. G. (2002). Mycorrhization of coriander (.) to enhance the concentration and quality of essential oil. Journal of the Science and Food Agriculture, 82(4), 339-342. [Google Scholar] [CrossRef]
Copetta, A., Lingua, G., & Berta, G. (2006). Effects of three AM fungi on growth, distribution of glandular hairs, and essential oil production in Ocimum basilicum L. var. Genovese. Mycorrhiza, 16(7), 485-494. [Google Scholar] [CrossRef]
Guo, H., Li, R., Liu, S., Zhao, N., & Han, S. (2016). Molecular characterization, expression, and regulation of 1. Plant Physiology and Biochemistry, 109(1), 230-239. [Google Scholar] [CrossRef]
Zhang, M., Wang, S., Yin, J., Li, C., & Zhan, Y. (2016). Molecular cloning and promoter analysis of and genes from . Protoplasma, 253(5), 1347-1363. [Google Scholar] [CrossRef]
Xu, Y. H., Yang, X., Zhang, Z., Liang, L., & Wei, J. H. (2013). Cloning and expression analysis of from . Acta Pharmaceutica Sinica, 48(6), 953-959. [Google Scholar]
Liu, Y., Xu, Q. X., Xi, P. Y., Chen, H. H., & Liu, C. S. (2013). Cloning and characterization of a cDNA coding involved in glycyrrhizic acid biosynthesis in . Acta Pharmaceutica Sinica, 48(5), 773-779. [Google Scholar]